View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21194_low_17 (Length: 291)
Name: NF21194_low_17
Description: NF21194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21194_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 19 - 281
Target Start/End: Complemental strand, 48888958 - 48888696
Alignment:
| Q |
19 |
acatatatatcagttaccttgttgtcaaatccagaagtaacaacttcttcttcagcagctgctaacaatttgattaatccaaattgtttactgtcaaact |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48888958 |
acatatatatcagttaccttgttgtcaaatccagaagtaacaacttcttcttcagcagctgctaacaatttgattaatccaaattgtttactgtcaaact |
48888859 |
T |
 |
| Q |
119 |
taccactatagccaatgcctggaatccatctaatgatcactccatcatagctgctagacaaaagcatcttttcacttttgttgagcagattcaaaacagt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48888858 |
taccactatagccaatgcctggaatccatctaatgatcactccatcatagctgctagacaaaagcatcttttcacttttgttgagcagattcaaaacagt |
48888759 |
T |
 |
| Q |
219 |
gatattcttcatgtgaccagataaggactttgggctttgatctagatccttagcagagtataa |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48888758 |
gatattcttcatgtgaccagataaggactttgggctttgatctagatccttagcagagtataa |
48888696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University