View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21194_low_19 (Length: 272)
Name: NF21194_low_19
Description: NF21194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21194_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 262
Target Start/End: Complemental strand, 34754690 - 34754429
Alignment:
| Q |
1 |
ctgcgatggtattgtctataaatttgatgaggtcttcaggtgtgtaaatctgagaagaagtgcacgctttcaaaacaccgaggtccaccaaatcaaccaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34754690 |
ctgcgatggtattgtctataaatttgatgaggtcttcaggtgtgtaaatctgagaagaagtgcacgctttcaaaacacagaggtccaccaaatcaaccaa |
34754591 |
T |
 |
| Q |
101 |
tgaagcactctcaaaatcagaggacagattggattgctcatgtatcattaaatatgtttttcccacctgcatgcagaatttggaaaacctaggatcttca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34754590 |
tgaagcactctcaaaatcagaggacagattggattgctcatgtatcattaaatatgtttttcccacctgcatgcagaatttggaaaacctaggatcttca |
34754491 |
T |
 |
| Q |
201 |
aatgtttttatcatatccacgatgcaatcatgagtcccttctagagcatgcacgtgtttcat |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
34754490 |
aatgtttttatcatatccacgatgcaatcacgagtcccttctaaagcatgcacgtgtttcat |
34754429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University