View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21195_low_4 (Length: 265)
Name: NF21195_low_4
Description: NF21195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21195_low_4 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 94 - 265
Target Start/End: Original strand, 38299196 - 38299367
Alignment:
| Q |
94 |
ggttttcataaaatcaaacggctaacccgtttaaccctgacccgagggtacccgtttagggtttcggatcgtacatcaatttggggggaatataaatagt |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38299196 |
ggttttcataaaatcaaacggctaacccgtttaaccctgacccgagggtacccgtttagggtttcggatcgtacatcaatttggggggaatataaatagt |
38299295 |
T |
|
| Q |
194 |
aagcccgggaagaactcatttctcactgtctcttcctcttcttcatttccttagtctctctctccaaaaccc |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38299296 |
aagcccgggaagaactcatttctcactgtctcttcctcttcttcatttccttagtctctctctccaaaaccc |
38299367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 97; Significance: 9e-48; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 101 - 265
Target Start/End: Complemental strand, 4583351 - 4583192
Alignment:
| Q |
101 |
ataaaatcaaacggctaacccgtttaaccctgacccgagggtacccgtttagggtttcggatcgtacatcaatttggggggaatataaatagtaagcccg |
200 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||||||| || |||||||||||| |||| |||||||||||||||| ||||||||||||||||| | |
|
|
| T |
4583351 |
ataaaattaaacggctaacccgtttaacc-tgacccgagggcacg-gtttagggtttcagatcatacatcaatttggggg-aatataaatagtaagcctg |
4583255 |
T |
|
| Q |
201 |
ggaagaactcatttctcactgtctcttcctcttcttcatttccttagtctctctctccaaaaccc |
265 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
4583254 |
ggaagaactcatttctcacagtctcttcctcttcttcatttcctt-gt-tctctctccaaaaccc |
4583192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University