View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21196_high_10 (Length: 276)
Name: NF21196_high_10
Description: NF21196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21196_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 12 - 260
Target Start/End: Complemental strand, 32828604 - 32828356
Alignment:
| Q |
12 |
tgaagcgacgaagggtgatcaaaggcttgaggaaaatgagtgtccactggggttggatgagagtaagagtcaagaactggagcttgtagttgtattggac |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32828604 |
tgaagcgacgaagggtgatcaaaggcttgaggaaaatgagtgtccagtggggttggatgagagtaagagtcaagaagtggagcttgtagttgtattggac |
32828505 |
T |
 |
| Q |
112 |
acaggtgaggggagtgcttcgtttccagagactgaattggctcatgagaatccaatagattcgagggatgagaatgctgctacagggaacgaggagagaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32828504 |
acaggtgaggggagtgcttcgtttccagagactgaattggctcatgagaatccaatagattcgagggatgagaatgctgctacaaggaacgaggagagaa |
32828405 |
T |
 |
| Q |
212 |
ttgaaactgacaatttgcaagctgaggagtgtagtggcgatgttgaacc |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32828404 |
ttgaaactgacaatttgcaagctgaggagtgtagtggcgatgttgaacc |
32828356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University