View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21196_low_12 (Length: 252)

Name: NF21196_low_12
Description: NF21196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21196_low_12
NF21196_low_12
[»] chr4 (1 HSPs)
chr4 (181-252)||(39146036-39146107)


Alignment Details
Target: chr4 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 181 - 252
Target Start/End: Complemental strand, 39146107 - 39146036
Alignment:
181 ttgatttggtgtgaccatatggtgtcggttaaatagtgagaatttgatcttataattttaagagacaaaatt 252  Q
    ||||||| |||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
39146107 ttgattttgtgtaaccatatggtgtcagttaaatagtgagaatttgatcttataattttaagagacaaaatt 39146036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University