View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21196_low_7 (Length: 322)
Name: NF21196_low_7
Description: NF21196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21196_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 13 - 305
Target Start/End: Complemental strand, 8804074 - 8803786
Alignment:
| Q |
13 |
aaaatctgcaaggatattttggacccactgattggatggatcgtcaagggaggtcatgtgtgtcaatcaaggcaaactattgcttgatttaccattcttc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8804074 |
aaaatctgcaaggatattttggacccactgattggatggatcgtcaagggaggtcatgtgtgtcaatcaaggcaaactattgcttgatttaccattcttc |
8803975 |
T |
 |
| Q |
113 |
tttgaaaccttcaccttcacacagatgggtttcttaacccctctttctcttttccttgnnnnnnnnnnnaccacattggtttcgttagtgtgggattttg |
212 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
8803974 |
tttgaaaccttcaccttcacagagatgggtttcttaacccctctttctcttttccttg---ttttttttaccacattggtttcgttagtgtggga-tttg |
8803879 |
T |
 |
| Q |
213 |
gctccacatattatatgctttcatttgcgtaaattaatagtaatttttaatcatgctgagcattcgtccttcaaacaatttcatgcttaactt |
305 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
8803878 |
gctccactaattatatgctttcatttgcgtaaattaatagtaatttttaatcatgctgaacattcgtccttcaaaaaatttcatgcttaactt |
8803786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University