View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21197_high_27 (Length: 372)
Name: NF21197_high_27
Description: NF21197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21197_high_27 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 120; Significance: 3e-61; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 120; E-Value: 3e-61
Query Start/End: Original strand, 200 - 340
Target Start/End: Original strand, 26405562 - 26405706
Alignment:
| Q |
200 |
ctgtctgtctgtcgtcgcttttcttctactactccaag----caagcaaagctgtctgccactgcacgttgtttcattcaacttgcattcatttctatct |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
26405562 |
ctgtctgtctgtcgtcgcttttcttctactactccaagcaagcaagcaaagctgtctgccactgcacgttgtttcattcaagttgcattcatttctatct |
26405661 |
T |
|
| Q |
296 |
caggttcattttcaattttctatttcaaatttatgatatcattct |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
26405662 |
caggttcattttcaattttctatttcaaattcatgatatcattct |
26405706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 120; E-Value: 3e-61
Query Start/End: Original strand, 33 - 173
Target Start/End: Complemental strand, 26405706 - 26405562
Alignment:
| Q |
33 |
agaatgatatcataaatttgaaatagaaaattgaaaatgaacctgagatagaaatgaatgcaagttgaatgaaacaacgtgcagtggcagacagctttgc |
132 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
26405706 |
agaatgatatcatgaatttgaaatagaaaattgaaaatgaacctgagatagaaatgaatgcaacttgaatgaaacaacgtgcagtggcagacagctttgc |
26405607 |
T |
|
| Q |
133 |
ttg----cttggagtagtagaagaaaagcgacgacagacagacag |
173 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26405606 |
ttgcttgcttggagtagtagaagaaaagcgacgacagacagacag |
26405562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University