View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21197_high_40 (Length: 330)
Name: NF21197_high_40
Description: NF21197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21197_high_40 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 20 - 318
Target Start/End: Original strand, 46892408 - 46892706
Alignment:
| Q |
20 |
ttatctatggcttaattcttctcaatcactcttccctattgcacttcttaccaactcatccgtccacgtcatcatgtactcttactacttcctcaccacc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46892408 |
ttatctatggcttaattcttctcaatcactcttccctattgcacttcttaccaactcatccgtccacgtcatcatgtactcttactacttcctcaccacc |
46892507 |
T |
 |
| Q |
120 |
gttggtatccgaccgccttggaaacgcgtcgttaccgactgccagattgttcagttcgtgttcagcttcgccgtctccggtctcatgctttattatcact |
219 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46892508 |
gttggaatccgaccgccttggaaacgcgtcgttaccgactgccagattgttcagttcgtgttcagcttcgccgtctccggtctcatgctttattatcact |
46892607 |
T |
 |
| Q |
220 |
tcggatccgatggtggtggatgctctgggatgaaggcttggtgtttcaatgctgtttttaatgcttctcttttggctctttttcttgattttcatctca |
318 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46892608 |
tcggatccgatggtggtggatgctgtgggatgaaggcttggtgtttcaatgctgtttttaatgcttctcttttggctctttttcttgattttcatctca |
46892706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University