View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21197_high_44 (Length: 306)
Name: NF21197_high_44
Description: NF21197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21197_high_44 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 54 - 293
Target Start/End: Complemental strand, 944223 - 943984
Alignment:
| Q |
54 |
ttgatgtgcccaaatattttcattgtgccttatttcataattgtattgctttgaaatttgcctaattataattatgatattgtcaaatgacagggtttat |
153 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
944223 |
ttgatgtgcccaaatattttcactgtgccttattttataattgtattgctttgaaatttgcctaattataattatgatattgtcaaatgacagggtttat |
944124 |
T |
|
| Q |
154 |
cagcttcttggtgaagccggcacatactacggtgtacgcttcggaaaaactattccatgggtaaccgaattccctttcggggtcatcagtgatcctcagt |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
944123 |
cagcttcttggtgaagccggcacatactacggtgtacgcttcggaaaaactattccatgggtaaccgaattccctttcggggtcatcagtgatcctcagt |
944024 |
T |
|
| Q |
254 |
atattggcagcatcatgagtcttattgcatgccttccatg |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
944023 |
atattggcagcatcatgagtcttattgcatgccttccatg |
943984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 56 - 285
Target Start/End: Complemental strand, 946726 - 946496
Alignment:
| Q |
56 |
gatgtgcccaaatattttcattgtgccttatttcataattgtattgctttgaaattt-gcctaattataattatgatattgtcaaatgacagggtttatc |
154 |
Q |
| |
|
|||||||| |||||| || ||| |||||| || ||| ||||||||||||| |||| | ||||| ||||| || ||||||||||||||||||||||||| |
|
|
| T |
946726 |
gatgtgcctgaatattctcgttgagccttaatttttaactgtattgctttgatattttgtctaatcataatgatcatattgtcaaatgacagggtttatc |
946627 |
T |
|
| Q |
155 |
agcttcttggtgaagccggcacatactacggtgtacgcttcggaaaaactattccatgggtaaccgaattccctttcggggtcatcagtgatcctcagta |
254 |
Q |
| |
|
|||| ||||||||| ||||||| ||||| ||||||||||| |||||||||||||| |||||||| |||||||||||||||||||| |||||||| ||||| |
|
|
| T |
946626 |
agctgcttggtgaacccggcacgtactatggtgtacgctttggaaaaactattccctgggtaactgaattccctttcggggtcattagtgatccacagta |
946527 |
T |
|
| Q |
255 |
tattggcagcatcatgagtcttattgcatgc |
285 |
Q |
| |
|
| | |||||||||||||||||| |||||||| |
|
|
| T |
946526 |
tgtcggcagcatcatgagtcttgttgcatgc |
946496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University