View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21197_high_46 (Length: 273)
Name: NF21197_high_46
Description: NF21197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21197_high_46 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 258
Target Start/End: Original strand, 37276855 - 37277095
Alignment:
| Q |
18 |
cacagaagatggtgctgaactcgtgtccggatgagaatcatttgttaaagaggaagaatttctttctagtgtgaaatctttacttgacccctcttcattc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
37276855 |
cacagaagatggtgctgaactcgtgtccggatgagaatcatttgttaaagaggaagaatttatttctagggtgaaatctttacttgacccctcttcattc |
37276954 |
T |
 |
| Q |
118 |
atgttagtcttcaaggctgaatactttctgccaccaatttttctgctcatgtcagcttcttcatttttggtctctaccatgatagttgttttatcttcgc |
217 |
Q |
| |
|
| ||| ||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37276955 |
aggtttgtccttaaggctgaatactttctgccaccaatttttctgctcatgtcagcttcttcatttttggtctctaccatgatagttgttttatcttcgc |
37277054 |
T |
 |
| Q |
218 |
ttgcgacactctcatccagagcctgtgaaagtatcataaat |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37277055 |
ttgcgacactctcatccagagcctgtgaaagtatcataaat |
37277095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University