View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21197_high_57 (Length: 250)
Name: NF21197_high_57
Description: NF21197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21197_high_57 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 17180556 - 17180318
Alignment:
| Q |
1 |
tgttaatctgtcacaatattttatgagttatttaattcaaagccttgttttg-aaaagtttaaattaatgtataaaatagattttatctaatagaaattt |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
17180556 |
tgttaatctgtcacaatattttatgagttatttaattgaaagccttgttttggaaaagtttaaattcatgtataaaatagattttatctaatagaaattt |
17180457 |
T |
|
| Q |
100 |
tatgatcaacttaaatccgttgcatctactttatggtgcaaccgatataaagaccattaatcataaagagat--aaatgtttttcttttgattaaaatct |
197 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| | ||||||||||||||| ||||||||| ||| |||||||||||||||||| |
|
|
| T |
17180456 |
tatgatcaacttgaatccgttgcatctactttatggtgcaaccgttgtaaagaccattaatcttaaagagataaaaaaaaaattcttttgattaaaatct |
17180357 |
T |
|
| Q |
198 |
ttaccgatgttgcaccattgagcagtgacatccgttctt |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17180356 |
ttaccgatgttgcaccattgagcagtgacatccgttctt |
17180318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University