View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21197_high_61 (Length: 242)
Name: NF21197_high_61
Description: NF21197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21197_high_61 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 39072281 - 39072501
Alignment:
| Q |
1 |
tgccattcaatatctaccattggatttagcagaaagtaccttagataattgattctgaatgacacacaaagagccaataacttttgttgcatactgaact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
39072281 |
tgccattcaatatctaccattggatttagcagaaagtaccttagataattgattctgaatgacacacaaagagccaataacttttgctgcatactgaact |
39072380 |
T |
 |
| Q |
101 |
tgacctggacaaacacatcagcaactaaagttatcaattgcaggctttgagagaaaaaattaacaatgtcaaattttgtttattatcgggtacaacaatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
39072381 |
tgacctggacaaacacatcagcaactaaagttatcaattgcaggctttgagagaaaaaattaacaatgtcaaattttgtttattatc-ggtacaacaatt |
39072479 |
T |
 |
| Q |
201 |
acctatttcattgacaaagtag |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
39072480 |
acctatttcattgacaaagtag |
39072501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 7 - 134
Target Start/End: Original strand, 40170327 - 40170455
Alignment:
| Q |
7 |
tcaatatctaccattggatttagcagaaagtaccttagataattgattctgaatgacacacaaagagccaata-acttttgttgcatactgaacttgacc |
105 |
Q |
| |
|
|||||||||| ||| || |||||| || ||||| || |||| |||||||||||||| |||||| |||||||| ||| || |||||| ||||||| ||| |
|
|
| T |
40170327 |
tcaatatctaatattagacttagcataaggtaccgtacataactgattctgaatgacgcacaaatagccaatagccttctgctgcatattgaacttaacc |
40170426 |
T |
 |
| Q |
106 |
tggacaaacacatcagcaactaaagttat |
134 |
Q |
| |
|
| ||||||| ||||| |||||||||| |
|
|
| T |
40170427 |
ttcacaaacatatcagatgctaaagttat |
40170455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University