View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21197_high_64 (Length: 238)
Name: NF21197_high_64
Description: NF21197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21197_high_64 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 12 - 222
Target Start/End: Complemental strand, 2787993 - 2787783
Alignment:
| Q |
12 |
atgaaaataaggtaaatagaagttttctatcttctatttttgggagatgcatgagttctccagcaattcgagaatgataatgatcatttgtttgtacttt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2787993 |
atgaaaataaggtaaatagaagttttctatcttctatttttgggagatgcatgagttctccagcaattcgagaatgataatgatcatttgtttgtacttt |
2787894 |
T |
|
| Q |
112 |
gtcatttcttatcttatgtttcatgttatgcaaatatgtcaaacattgttccttttttaatgaacaatattttatttcttcattatttcaattaatatat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2787893 |
gtcatttcttatcttatgtttcatgttatgcaaatatgtcaaacattgttccttttttaatgaacaatattttatttcttcattatttcaattaatatat |
2787794 |
T |
|
| Q |
212 |
gttcttccatg |
222 |
Q |
| |
|
||||||||||| |
|
|
| T |
2787793 |
gttcttccatg |
2787783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University