View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21197_high_66 (Length: 229)
Name: NF21197_high_66
Description: NF21197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21197_high_66 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 9 - 223
Target Start/End: Original strand, 30834527 - 30834741
Alignment:
| Q |
9 |
gaggcaccggttagcagttcccaaagtaaattgatgcagagtttgtaagctattagccgtcattcggtctcttttacaatccatgaatttattccattat |
108 |
Q |
| |
|
||||||| |||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30834527 |
gaggcactggttagcattttccaaagtaaattgatgcagagtttgtaagctattagccgtcattcggtctcttttacaatccatgaatttattccattat |
30834626 |
T |
 |
| Q |
109 |
atccgatatcaaaccaacaattaagtggtttgactcaaataaataacaatgatgatagttaaacatccatgattcccatatactaattcaacacttcatt |
208 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30834627 |
atctgatatcaaaccaacaattaagtggtttgactcaaataaataacaatgatgatagttaaacatccatgattcccatatactaattcaacacttcatt |
30834726 |
T |
 |
| Q |
209 |
ttctccttgtctctc |
223 |
Q |
| |
|
||||| ||||||||| |
|
|
| T |
30834727 |
ttctctttgtctctc |
30834741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University