View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2119_high_9 (Length: 243)
Name: NF2119_high_9
Description: NF2119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2119_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 38628425 - 38628192
Alignment:
| Q |
1 |
tggtatgcaagtatgtatatatgctgttggatactaattaaggttgaggtgaagaatatatgcctcatcatgagtatatatataggttggaaaatatatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38628425 |
tggtatgcaagtatgtatatatgctgttggatactaattaaggttgaggtgaagaatatatgcctcat---gagtatatatataggttggaaaatatatg |
38628329 |
T |
 |
| Q |
101 |
aaggggaggaggtgagagtaggtcttactttggaaagaaaa-cgtgtttggctgtagccttcaatgttaaataaaacttgaagtaatctacttttgaaca |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
38628328 |
aaggggaggaggtgagagtaggtcttactttggaaacaaaaacgtgtttggctgtagccttcaatgttaaacaaaacttgaagtaatctacttttgaaca |
38628229 |
T |
 |
| Q |
200 |
cttcttcttgctcagtctggatgctatgcctatgctt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
38628228 |
attcttcttgctcagtctggatgctatgcctatgctt |
38628192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 99 - 207
Target Start/End: Original strand, 38698003 - 38698112
Alignment:
| Q |
99 |
tgaaggggaggaggtgagagtaggtcttactttggaaagaaaa-cgtgtttggctgtagccttcaatgttaaataaaacttgaagtaatctacttttgaa |
197 |
Q |
| |
|
||||||||| ||| ||||||||||| |||||||| ||| |||| |||||||||||| |||||||||| ||| | | || |||||| |||| ||||||||| |
|
|
| T |
38698003 |
tgaaggggaagagatgagagtaggtattactttgtaaacaaaaacgtgtttggctgcagccttcaattttagacagaagttgaagcaatccacttttgaa |
38698102 |
T |
 |
| Q |
198 |
cacttcttct |
207 |
Q |
| |
|
| |||||||| |
|
|
| T |
38698103 |
ctcttcttct |
38698112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University