View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2119_low_13 (Length: 268)
Name: NF2119_low_13
Description: NF2119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2119_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 18 - 247
Target Start/End: Original strand, 43407834 - 43408057
Alignment:
| Q |
18 |
ggaatatggtggtgggttagtggctgacggtggtgtgtttggaccgatggtgnnnnnnnnnnnnnnnnnnnnnnatcaagcagatataattgaggagctc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43407834 |
ggaatatggtggtgggttagtggctgacggtggtgtgtttggaccgatggtgggaggaggaggaggag------atcaagcagatataattgaggagctg |
43407927 |
T |
|
| Q |
118 |
ttgggagaaggttgctggattgaagcaagtgagaacagtttgatgtccatgcagcaaactacgccacaatcacaatacatgtccaacaataataatattc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43407928 |
ttgggagaaggttgctggattgaagcaagtgagaatagtttgatggccatgcagcaaactacgccacaatcacaatacatgtccaacaataataatattc |
43408027 |
T |
|
| Q |
218 |
ctatgggaatgggagagggagatcacttca |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
43408028 |
ctatgggaatgggagagggagatcacttca |
43408057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University