View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2119_low_14 (Length: 268)
Name: NF2119_low_14
Description: NF2119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2119_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 3e-94; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 35 - 260
Target Start/End: Complemental strand, 17244743 - 17244517
Alignment:
| Q |
35 |
aaaggttattattgaaccgcaactttgataaggaattcatgtcacggagnnnnnnnn-ctttctcaattgattattgatagttttaaacatacatatgtg |
133 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
17244743 |
aaaggttattattgaaccgcaactttcataaggaattcatgtcacggagattttttttctttcacaattgattattgatagttttaaacatacatatgtg |
17244644 |
T |
|
| Q |
134 |
tgaatgaaaaagagatgataatacttgccctagttggtgcaggtccaagaagtattcttgctctggttatcactccaaattgacctagtcctccaagaac |
233 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17244643 |
tgaacgaaaaagagatgataatacttgccctagttggtgcaggtccaagaagtattcttgctctggttatcactccaaattgacctagtcctccaagaac |
17244544 |
T |
|
| Q |
234 |
ggcataaaacacctctgagttcatctc |
260 |
Q |
| |
|
||||||||| |||||||||||| |||| |
|
|
| T |
17244543 |
ggcataaaatacctctgagttcttctc |
17244517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 3 - 38
Target Start/End: Original strand, 22963409 - 22963444
Alignment:
| Q |
3 |
tatggtgaagtcgtaagaatgacttttctggtaaag |
38 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22963409 |
tatggtgaagtcataagaatgacttttctggtaaag |
22963444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 3 - 38
Target Start/End: Complemental strand, 22998068 - 22998033
Alignment:
| Q |
3 |
tatggtgaagtcgtaagaatgacttttctggtaaag |
38 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22998068 |
tatggtgaagtcataagaatgacttttctggtaaag |
22998033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 17245151 - 17245114
Alignment:
| Q |
1 |
tctatggtgaagtcgtaagaatgacttttctggtaaag |
38 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
17245151 |
tctatggtgaagtcgcgagaatgacttttctggtaaag |
17245114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 169 - 260
Target Start/End: Original strand, 52451917 - 52452008
Alignment:
| Q |
169 |
ggtgcaggtccaagaagtattcttgctctggttatcactccaaattgacctagtcctccaagaacggcataaaacacctctgagttcatctc |
260 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||| | |||||||| ||||| ||||||||||| |||||||| | ||||||||| |||| |
|
|
| T |
52451917 |
ggtgcaggtccaagagctattcttgctcgggttataatcccaaattggcctagacctccaagaaccgcataaaataattctgagttcttctc |
52452008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 19631756 - 19631789
Alignment:
| Q |
1 |
tctatggtgaagtcgtaagaatgacttttctggt |
34 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
19631756 |
tctatggtgaagtcataagaatgacttttctggt |
19631789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 25501094 - 25501057
Alignment:
| Q |
1 |
tctatggtgaagtcgtaagaatgacttttctggtaaag |
38 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
25501094 |
tctatggtgaagtcatgagaatgacttttctggtaaag |
25501057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University