View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2119_low_17 (Length: 219)
Name: NF2119_low_17
Description: NF2119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2119_low_17 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 17 - 205
Target Start/End: Complemental strand, 34180868 - 34180680
Alignment:
| Q |
17 |
ttctcatggaataaaatcgttaaactaattaattttagtttgatgatagttagacaaataatgtttgaaatatcatataggaatcatttgggttatgaaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34180868 |
ttctcatggaataaaatcgttaaactaattaattttagtttgatgatagttagacaaataatgtttgaaatatcatataggaatcatttgggttatgaaa |
34180769 |
T |
|
| Q |
117 |
ccatcagttataacatatgatctttattattttaacnnnnnnnntatacttcttattatggtctacggattgaatttgttttctttttt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34180768 |
ccatcagttataacatatgatctttattattttaacaaaaaaaatatacttcttattatggtctacggattgaatttgttttctttttt |
34180680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University