View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2119_low_7 (Length: 363)
Name: NF2119_low_7
Description: NF2119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2119_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 11 - 343
Target Start/End: Original strand, 17744797 - 17745129
Alignment:
| Q |
11 |
tgaaacagctgaataatcaactgcacttgcagttaccacactccattcaatgcttgcttcacttggtgcataaaaatttggactagtgcaaccagaagca |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17744797 |
tgaaacagctgaataatcaactgcacttgcagttaccacactccattcaatgcttgcttcacttggtgcataaaaatttggactagtgcaaccagaagca |
17744896 |
T |
 |
| Q |
111 |
acatgtgatgttgttgttcttgataaaaatgagcttgttttattaccagtgaaactttcaatctcaaataaatctgaacttgcatcacttccaannnnnn |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17744897 |
acatgtgatgttgttgttcttgataaaaatgagcttgttttattaccagtgaagctttcaatctcaaataaatctgaacttgcatcacttccaacatcat |
17744996 |
T |
 |
| Q |
211 |
nnnnnnnnnnnnnncaatttgtagaaaaatcaatttcttgttcttcaagtttagtagcagcttcccaagatggtatttttagcctcatatcaaagcttat |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
17744997 |
catcatcatcatcacaatttgtagaaaaatcaatttcttgttcttcaagttttgaagcagcttcccaagatggtatttttagtctcatatcaaagcttat |
17745096 |
T |
 |
| Q |
311 |
tgacttgcatctttcatctaatattggtgaacc |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
17745097 |
tgacttgcatctttcatctaatattggtgaacc |
17745129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 168 - 200
Target Start/End: Complemental strand, 24336907 - 24336875
Alignment:
| Q |
168 |
tcaatctcaaataaatctgaacttgcatcactt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
24336907 |
tcaatctcaaataaatctgaacttgcatcactt |
24336875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 33 - 73
Target Start/End: Complemental strand, 24337042 - 24337002
Alignment:
| Q |
33 |
gcacttgcagttaccacactccattcaatgcttgcttcact |
73 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
24337042 |
gcacttgcagttaccacactccattctatgcttgcctcact |
24337002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University