View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21200_high_7 (Length: 245)
Name: NF21200_high_7
Description: NF21200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21200_high_7 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 8 - 245
Target Start/End: Complemental strand, 33771726 - 33771489
Alignment:
| Q |
8 |
tgagatgaaacaggagaagaatcaggataagtcatgggaagtggaagaggctcaccattatcaaccatgtaaccttctctatttcgtgaccattttctct |
107 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33771726 |
tgagacgaaacaggagaagaatcaggataagtcatgggaagtggaagaggctcaccattatcaaacatgtaaccttctctatttcgtgaccattttctct |
33771627 |
T |
 |
| Q |
108 |
ccttcgctttcaccttcatccactcgttcccaccggcgcgtctaactgcggcgccgccagtttcaacggcaggtagtcttccagaagtggtgggcagtga |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
33771626 |
ccttcgctttcaccttcatccactcgttcccaccggcgcgtctaactgcggcgccgccagtttcaacggcaggtagtcttcccgaagtggtgggcagtga |
33771527 |
T |
 |
| Q |
208 |
gagtgaggagtggaagagacgagggaaggaggtggggt |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33771526 |
gagtgaggagtggaagagacgagggaaggaggtggggt |
33771489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University