View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21200_high_9 (Length: 219)
Name: NF21200_high_9
Description: NF21200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21200_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 92; Significance: 7e-45; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 18 - 109
Target Start/End: Complemental strand, 36133161 - 36133070
Alignment:
| Q |
18 |
acagctagcttcgtagccttctctttccattttaagagagataactctttaagcatgtacgcttctgcttcattcttcacatcctgtttcaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36133161 |
acagctagcttcgtagccttctctttccattttaagagagataactctttaagcatgtacgcttctgcttcattcttcacatcctgtttcaa |
36133070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 171 - 205
Target Start/End: Original strand, 36134619 - 36134653
Alignment:
| Q |
171 |
ccccatctttttccatttggtgattatgctctgtg |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
36134619 |
ccccatctttttccatttggtgattatgctctgtg |
36134653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 18 - 109
Target Start/End: Complemental strand, 30813514 - 30813423
Alignment:
| Q |
18 |
acagctagcttcgtagccttctctttccattttaagagagataactctttaagcatgtacgcttctgcttcattcttcacatcctgtttcaa |
109 |
Q |
| |
|
||||||||| | ||||||||||||| |||||| || |||||||||||||| |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
30813514 |
acagctagcgttgtagccttctcttgccatttcaacagagataactctttgagcatgtatgcttctgcttcattcttcacatcctgtttcaa |
30813423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University