View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21201_low_11 (Length: 210)
Name: NF21201_low_11
Description: NF21201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21201_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 25265019 - 25264821
Alignment:
| Q |
1 |
atcaagattatttcttttacccatttcttttactctgaaatgggtgtgtgttgtagtgactgacggaaggggtagaagaaacaatcttgatggagaaacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
25265019 |
atcaagattatttcttttacccatttcttttactctgaaatgggtgtgtgttgtagtgactggcggaagaggtagaagaaacaatcttgatggagaaacc |
25264920 |
T |
 |
| Q |
101 |
gatgcaaacattcttgatatggatatgtaactaggtgacccttagtcagaacaaacatattatctcataagtctcgaccctcttagtatgcaggttcat |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25264919 |
gatgcaaacattcttgatatggatatgtaactaggtgacccttagtcagaacaaacatattatctcataagtctcgaccctcttagtatgcaggttcat |
25264821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 36 - 64
Target Start/End: Original strand, 25265030 - 25265058
Alignment:
| Q |
36 |
tgaaatgggtgtgtgttgtagtgactgac |
64 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
25265030 |
tgaaatgggtgtgtgttgtagtgactgac |
25265058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University