View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21202_high_10 (Length: 242)
Name: NF21202_high_10
Description: NF21202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21202_high_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 47349337 - 47349563
Alignment:
| Q |
1 |
tgtggcaaaaatgctgtatgctggaagtagagaagatgaaaatcgataatctaaaggagggagataacaaatcaaaacttatgatgtcatgttgaaagta |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47349337 |
tgtggcaaaaatgttgtatgctggaagtagagaagatgaaaatcgataatctaaaggagggagataacaaatcaaaacttatgatgtcatgttgaaagta |
47349436 |
T |
|
| Q |
101 |
aagaataggagattaggagttataaagtttgtttgatggttagtgtgggagagtaaaagaatgaagtgattgggggagagatagttaaaattttcaatgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47349437 |
aagaataggagattaggagttataaagtttgtttgatggttagtgtgggagagtaaaagaatgaagtgattgggggagagatagttaaaattttcaatgc |
47349536 |
T |
|
| Q |
201 |
catgattaaatatcgattggaagaaag |
227 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
47349537 |
aatgattaaatatcgattggaagaaag |
47349563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University