View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21202_high_7 (Length: 393)
Name: NF21202_high_7
Description: NF21202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21202_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 356; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 356; E-Value: 0
Query Start/End: Original strand, 1 - 372
Target Start/End: Complemental strand, 29452025 - 29451654
Alignment:
| Q |
1 |
ctgaaagcatgacgtgtccatcttcgcgtagaagtacattctcaggtttcaagtcacggtataccacgccaagcgcgtgaagatactcgatagcaacaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29452025 |
ctgaaagcatgacgtgtccatcttcgcgtagaagtacattctcaggtttcaagtcacggtataccacgccaagcgcgtgaagatactcgagagcaacaag |
29451926 |
T |
 |
| Q |
101 |
aatctcggcagcgaaaaacctcgccgccgaaattgtgagtcggtttcccggctgtttacgtagaagagcgtggagatcaccgccgggacaatagtcaata |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29451925 |
aatctcggcagcgaaaaacctcgccgccgaaattgtgagtcggttccccggctgtttacgtagaagagcgtggagatcaccgccgggacaatagtcaata |
29451826 |
T |
 |
| Q |
201 |
aggaggcaagtgtagtgagaaacatcgatccgcgcatagagcgtcggtaaaaaaggatgatccagcgcgtgaagaatctccgcctccgtttccacgtgag |
300 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29451825 |
aggaggcacgtgtagtgagaaacatcgatccgcgcatagagcgtcggtaaaaaaggatgatccagcgcgtgaagaatctccgcctccgtttccgcgtgag |
29451726 |
T |
 |
| Q |
301 |
agaatttcttaggagtaagaaggtctttatcaacaaccttaagtgcaaaatttgcaccgtcgtagtcacgga |
372 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29451725 |
agaatttcttaggagtaagaaggtctttatcaacaaccttaagtgcaaaatttgcaccgtcgtagtcacgga |
29451654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University