View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21202_high_8 (Length: 310)
Name: NF21202_high_8
Description: NF21202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21202_high_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 109; Significance: 8e-55; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 8e-55
Query Start/End: Original strand, 18 - 134
Target Start/End: Complemental strand, 49655153 - 49655037
Alignment:
| Q |
18 |
atactttggttgccacatgttttggcttcacaatctacaaatttttgttctatagagcatacagtagttgtggtaagaagaagataaaaaagggtcatgt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
49655153 |
atactttggttgccacatgttttggcttcacaatctacaaatttttgttctatagagcatacagtggttgtggtaagaagaagataaaaaagggtgatgt |
49655054 |
T |
|
| Q |
118 |
atgaataaattaaggga |
134 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
49655053 |
atgaataaattaaggga |
49655037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 18 - 67
Target Start/End: Complemental strand, 49712675 - 49712626
Alignment:
| Q |
18 |
atactttggttgccacatgttttggcttcacaatctacaaatttttgttc |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49712675 |
atactttggttgccacatgttttggcttcacaatctacaaatttttgttc |
49712626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University