View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21202_low_12 (Length: 239)
Name: NF21202_low_12
Description: NF21202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21202_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 112; Significance: 9e-57; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 24 - 147
Target Start/End: Complemental strand, 7077704 - 7077581
Alignment:
| Q |
24 |
gtgatgaatcagtgggtggttgttctgatgaagaattgtggaaggcaattgcaggaccattggtggatgttccttgtgttggtcaaagtgttttctattt |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
7077704 |
gtgatgaatcagtgggtggttgttctgatgaagaattatggaaggcaattgcaggaccattggttgatgttccttgtgttggtcaaagtgttttctattt |
7077605 |
T |
 |
| Q |
124 |
cccacaagggcacatggaacaagt |
147 |
Q |
| |
|
||||||||| |||||||||||||| |
|
|
| T |
7077604 |
cccacaaggacacatggaacaagt |
7077581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University