View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21203_high_12 (Length: 238)
Name: NF21203_high_12
Description: NF21203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21203_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 72 - 222
Target Start/End: Complemental strand, 32977288 - 32977138
Alignment:
| Q |
72 |
gattttccattgttacaggattatctgtttttcccaaatggtatatggatttctgttgacatttcaacaaggttttattgttttttaacgataaactaca |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32977288 |
gattttccattgttacaggattatctgtttttcccaaatggtatatggatttctgttgacatttcaacaaggttttattgttttttaacgataaactaca |
32977189 |
T |
 |
| Q |
172 |
cacatttcgcattgtttaaataaaattaagtaatgagaacaccacctgtat |
222 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32977188 |
cacatttcgcattgtttaaatagaattaagtaatgagaacaccacctgtat |
32977138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University