View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21203_high_4 (Length: 288)
Name: NF21203_high_4
Description: NF21203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21203_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 32 - 279
Target Start/End: Original strand, 48527450 - 48527697
Alignment:
| Q |
32 |
ggtacaatttcaaaatctatcgatccatataatcaacaatttgtgagatcaaatggttaacatatcttctcaatgacctcaaatttactttcatcaaacc |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48527450 |
ggtacaatttcaaaatctatcgatccatataatcaacaatttgtgagatcaaatggttaacatatcttctcaatgacctcaaatttactttcatcaaacc |
48527549 |
T |
 |
| Q |
132 |
agccatgttatactgtgacaatcaatctgccgcaagacatattgctgccaattcatccttcctggagagaaccaaacacatagagctcgactgtcatatt |
231 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48527550 |
agccatgttatactgtgacaatcaatccgccgcaagacatattgctgccaattcatccttcctggagagaaccaaacacatagagctcgactgtcatatt |
48527649 |
T |
 |
| Q |
232 |
gttcgcgtaaagcttcaactaaaactatttcatattcttcatattctt |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48527650 |
gttcgcgtaaagcttcaactaaaactatttcatattcttcatattctt |
48527697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University