View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21203_high_5 (Length: 274)
Name: NF21203_high_5
Description: NF21203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21203_high_5 |
 | |
|
| [»] scaffold0186 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0186 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: scaffold0186
Description:
Target: scaffold0186; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 49 - 259
Target Start/End: Complemental strand, 26607 - 26382
Alignment:
| Q |
49 |
tggttacgccattgacaaaacatggttaagtcaatcacagttttggttagattttctaaaagc-------agacaaattttacggcgatatgttcataaa |
141 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||||| ||||||||| |||| |||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
26607 |
tggttacaccatggacaaaacatggttaagtcaatcacatatttggttagtttttttaaaagtctgttaaagacaaattttacggcgatatgtccataaa |
26508 |
T |
|
| Q |
142 |
agaacaaaacaacgt--------agttcaaagagacggtgatgaatcgctgtagcttactactattatggtaagcggataaagaaacaatatttctttaa |
233 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||| || | ||| |||| ||||||||||||| || ||||||||||||||| ||||| |
|
|
| T |
26507 |
agaacaaaacaacattcattagaagttcaaagagacggtgatgaatcactatggctgactattattatggtaagctgaaaaagaaacaatatttatttaa |
26408 |
T |
|
| Q |
234 |
ctaaacatggtctatttagttgttac |
259 |
Q |
| |
|
||||||||||||||||||| |||||| |
|
|
| T |
26407 |
ctaaacatggtctatttagctgttac |
26382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0186; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 2 - 51
Target Start/End: Original strand, 26631 - 26680
Alignment:
| Q |
2 |
ttctccctcgctaatgttccacgtgatttttgtggaaggaatacatttgg |
51 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26631 |
ttctccctcactaatgttccacgtgatttttgtggaaggaatacatttgg |
26680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 60 - 108
Target Start/End: Original strand, 23109387 - 23109435
Alignment:
| Q |
60 |
ttgacaaaacatggttaagtcaatcacagttttggttagattttctaaa |
108 |
Q |
| |
|
|||| |||||||| ||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
23109387 |
ttgataaaacatgattaagtctatctcagttttggttagattttctaaa |
23109435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University