View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21205_high_67 (Length: 240)
Name: NF21205_high_67
Description: NF21205
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21205_high_67 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 1562967 - 1563194
Alignment:
| Q |
1 |
ttcttttactaccttattatataataactgcatcatcttttgcagctgttacgcagacatcgaagggtaaatgtcaaccagggtgtccttggccaagaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1562967 |
ttcttttactaccttattatataataactgcatcatcttttgcagctgttacgcagacatcgaagggtaaatgtcaaccagggtgtccttggccaagaag |
1563066 |
T |
 |
| Q |
101 |
aggtatggaacc------tgacacatatagaaattacttttataggctgctgagtatactttgatgttatgttagtgatcaacgaccaaatataaagaaa |
194 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1563067 |
aggtatggaacctgcatttgacacatatagaaattacttttataggctgctgagtatactttgatgttatgttagtgatcaacgaccaaatataaagaaa |
1563166 |
T |
 |
| Q |
195 |
gttacacctgtctaccataggtttgaac |
222 |
Q |
| |
|
|||||||||||||||||||| ||||||| |
|
|
| T |
1563167 |
gttacacctgtctaccatagttttgaac |
1563194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University