View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21205_high_69 (Length: 239)
Name: NF21205_high_69
Description: NF21205
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21205_high_69 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 19 - 229
Target Start/End: Original strand, 38968785 - 38968995
Alignment:
| Q |
19 |
ttatttgcccatgcattggcctaattttatcttgccatcttgtgtggttttatataatttttgaaatagattttttgacttctcaaccttggttggtggc |
118 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| | |
|
|
| T |
38968785 |
ttatttgcccatccattggcctaattttatcttgccatcttgtgtggttttatataatttttgaaaaagattttttgacttctcaaccttggttggtgac |
38968884 |
T |
 |
| Q |
119 |
tccattacattagcactcaaccccggttcnnnnnnnncaatgcatgttatgttgtgtttcattcactgtactggtgtattacttcttttttcaaaacaag |
218 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38968885 |
tccattacattagcactcaaccccggttcttttttttcaatgcatgttatgttgtgtttcattcactgtactggtgtattacatcttttttcaaaacaag |
38968984 |
T |
 |
| Q |
219 |
catgccctttg |
229 |
Q |
| |
|
||||||||||| |
|
|
| T |
38968985 |
catgccctttg |
38968995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University