View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21205_high_80 (Length: 219)
Name: NF21205_high_80
Description: NF21205
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21205_high_80 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 7 - 198
Target Start/End: Complemental strand, 35678317 - 35678126
Alignment:
| Q |
7 |
ataagaaaaaccactccaagaagagatagtagaaacccacttttaagtgaaggtagagatgaagatgaagctcttggacccatttgccctggttgtggaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35678317 |
ataagaaaaaccactccaagaagagatagtagaaacccacttttaagtgaaggtagagatgaagatgaagctcttggacccatttgccctggttgtggaa |
35678218 |
T |
 |
| Q |
107 |
ttttcatgcaagatactgatccaaatctccccggtttttaccaacaaaaagaggtaaaaattgaaacattttctaaggaggattatgaatta |
198 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
35678217 |
ttttcatgcaagataatgatccaaatctccctggtttttaccaacaaaaagaggtaaaaattgaaacattttctgaggaggattatgaatta |
35678126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University