View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21205_high_9 (Length: 556)
Name: NF21205_high_9
Description: NF21205
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21205_high_9 |
 |  |
|
| [»] scaffold0016 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 11 - 290
Target Start/End: Original strand, 6354205 - 6354491
Alignment:
| Q |
11 |
caaaggaggaaacttttagtaattttagaggctaacgttattgggttggaaaacactttgtaaacaccttgg-tagtgagatttcattagaggaaggat- |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| |||||||||||||||| |
|
|
| T |
6354205 |
caaaggaggaaacttttagtaattttagaggctaacgttattgggttggaaaacactttgtaaacactttgggtagtgagatctcattagaggaaggatc |
6354304 |
T |
 |
| Q |
109 |
-----attgacgagtttggtagcaaaaatggtggaaatcggctctttgaagaggtgtttcatgaataactccatcgatcttttcctattttacgatttgc |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6354305 |
aaaggattgacgagtttggtagcaaaaatggtggaaatcggctctttgaagaggtgtttcatgaataactccatcgatcttttcctattttacgatttgc |
6354404 |
T |
 |
| Q |
204 |
ggatgatacnnnnnnnatttgtgaagggaattgagagaatttatggtgtcttaaatctgttactagaatctttgcattgatttcggg |
290 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6354405 |
ggatgatactttttttatttgtgaagggaattgagagaatttatggtgtcttaaatctgttactagaatctttgcattgatttcggg |
6354491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 176; E-Value: 1e-94
Query Start/End: Original strand, 353 - 543
Target Start/End: Original strand, 6354573 - 6354766
Alignment:
| Q |
353 |
acattgttatattgatcaatttcctattaagttg---ggtattttgatgggtgccaatctaaggagagttgatacttggaagcctattgtgtcgtcgttg |
449 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6354573 |
acattgttatattgatcattttcctattaagttgttcggtattttgatgggtgccaatctaaggagagttgatacttggaagcctattgtgtcgtcgttg |
6354672 |
T |
 |
| Q |
450 |
atgaaaatgttgtctacttgttggaaaagtagacaattgtcaattagagagagtctgactttgattaactcagaattttcaatgatggtgttga |
543 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6354673 |
atgaaaatgttgtctacttgttggaaaagtagacaattgtcaattagagagagtctgactttgattaactcagaattttcaatgatggtgttga |
6354766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.0000000002; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 51 - 108
Target Start/End: Complemental strand, 3278261 - 3278204
Alignment:
| Q |
51 |
ttgggttggaaaacactttgtaaacaccttgg-tagtgagatttcattagaggaaggat |
108 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||||||||||| |||| |||| |
|
|
| T |
3278261 |
ttgggttggaaaaca-tttgtaaacaccttggatagtgagatttcattataggacggat |
3278204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 54 - 109
Target Start/End: Original strand, 28770613 - 28770668
Alignment:
| Q |
54 |
ggttggaaaacactttgtaaacaccttgg-tagtgagatttcattagaggaaggata |
109 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||||| ||||||| |||||||| |
|
|
| T |
28770613 |
ggttggaaaaca-tttgtaaacaccttgggtagtgagatctcattagctgaaggata |
28770668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 51 - 98
Target Start/End: Complemental strand, 37782124 - 37782077
Alignment:
| Q |
51 |
ttgggttggaaaacactttgtaaacaccttgg-tagtgagatttcatta |
98 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
37782124 |
ttgggttggaaaaca-tttgtaaacaccttgggtagtgagatttcatta |
37782077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 67 - 109
Target Start/End: Original strand, 31513184 - 31513227
Alignment:
| Q |
67 |
tttgtaaacaccttgg-tagtgagatttcattagaggaaggata |
109 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
31513184 |
tttgtaaacaccttgaatagtgagatttcattagaggaaggata |
31513227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 71 - 109
Target Start/End: Complemental strand, 30900108 - 30900069
Alignment:
| Q |
71 |
taaacaccttgg-tagtgagatttcattagaggaaggata |
109 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30900108 |
taaacaccttgggtagtgagatttcattagaggaaggata |
30900069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 29; Significance: 0.0000008; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 53 - 108
Target Start/End: Original strand, 102332 - 102387
Alignment:
| Q |
53 |
gggttggaaaacactttgtaaacaccttggta-gtgagatttcattagaggaaggat |
108 |
Q |
| |
|
||||||||||||| |||| ||||||||||||| || |||||| |||||||||||||| |
|
|
| T |
102332 |
gggttggaaaaca-tttgaaaacaccttggtaagtaagattttattagaggaaggat |
102387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 54 - 98
Target Start/End: Original strand, 33721398 - 33721441
Alignment:
| Q |
54 |
ggttggaaaacactttgtaaacaccttggtagtgagatttcatta |
98 |
Q |
| |
|
|||||| ||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
33721398 |
ggttgggaaaca-tttgtaaacacctttgtagtgagatttcatta |
33721441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University