View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21205_low_26 (Length: 384)
Name: NF21205_low_26
Description: NF21205
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21205_low_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 48 - 365
Target Start/End: Complemental strand, 32413008 - 32412684
Alignment:
| Q |
48 |
ctttttgtgcaacaaacaaaatgagaaagagactc-tagtgtggtgtacgtgttaccaatattatttttattgatcgaggcnnnnnnnnnnnnnnnnnnn |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32413008 |
ctttttgtgcaacaaacaaaatgagaaagagactcctagtgtggtgtacgtgacaccaatattatttttattgatcgaggcaaaaatgcaaaagaaaaaa |
32412909 |
T |
 |
| Q |
147 |
ngcaactaactaactccacataatgatgccagaggcatttgccaaaacgaggcttgagctatttgaggtggagcagtcagcagtttaccatatctttata |
246 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32412908 |
agcaactaactaacaccacataatgatgccagaggcatttgccaaaacgaggcttgagctatttgaggtggagcagtcagcagtgtaccatatctttata |
32412809 |
T |
 |
| Q |
247 |
gatccacaattcatgctagcaccaaactttgccaatcaatcaccacccaaaggatgagtgaaagaggttggttgaccaagag------atacacatttga |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
32412808 |
catccacaattcatgctagcaccaaactttgccaatcaatcaccacccaaaggatgaatgaatgaggttggttgaccaagagatactcatacacatttga |
32412709 |
T |
 |
| Q |
341 |
acttgatcaaaagcaatggcataag |
365 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
32412708 |
acttgatcaaaagcaatggcataag |
32412684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University