View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21205_low_49 (Length: 258)
Name: NF21205_low_49
Description: NF21205
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21205_low_49 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 52120330 - 52120091
Alignment:
| Q |
1 |
tctgaacaacaacatcaacctagtactattcgaaagattacgagaaattcttcggttaatgagctgaagaatattaacaaggttgttatggctaaagaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52120330 |
tctgaacaacaacatcaacctagtactattcgaaagattacgagaaattcttcggttaatgagctgaagaatattaacaaggttgttatggctaaagaaa |
52120231 |
T |
|
| Q |
101 |
gattttatgataacggtgaagatgacgatgaagatgaagatgatgatgctttgagttgttcgagttcggatttgtttgagcttgatcatcttgttggagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52120230 |
gattttatgataacggtgaagatgacgatgaagatgaagatgatgatgctttgagttgttcgagttcggatttgtttgagcttgatcatcttgttggagg |
52120131 |
T |
|
| Q |
201 |
tggaaggtatcaagaagagcttccagtttatgaaactacc |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52120130 |
tggaaggtatcaagaagagcttccagtttatgaaactacc |
52120091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University