View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21205_low_51 (Length: 256)
Name: NF21205_low_51
Description: NF21205
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21205_low_51 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 23 - 242
Target Start/End: Complemental strand, 15807274 - 15807055
Alignment:
| Q |
23 |
caaaggttggatgggtagttttgtgtcctagttgtgggttgaagattgatgattataatttctacgaaaatcaaacaggatctccatctcctctgccaaa |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| ||||||| |
|
|
| T |
15807274 |
caaaggttggatgggtagttttgtgtcctagttgtgggttgaagattgatgattataatttctacgaacaacaaacaggatctccatctcctttgccaaa |
15807175 |
T |
|
| Q |
123 |
tccaggtaatattaattgtttgtttttcaatttggatgcctttcaattttgtaaattgcagactcatcaatcttaggaaagataattaattagttgcttg |
222 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15807174 |
tccaggtaatattaattgtttgttttttaatttggatgcctttcaatgttgtaaattgcagactcatcaatcttaggaaagataattaattagttgcttg |
15807075 |
T |
|
| Q |
223 |
aggcacacttgtaggtgatg |
242 |
Q |
| |
|
||||||||||||||| |||| |
|
|
| T |
15807074 |
aggcacacttgtaggagatg |
15807055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 23 - 135
Target Start/End: Complemental strand, 15793856 - 15793744
Alignment:
| Q |
23 |
caaaggttggatgggtagttttgtgtcctagttgtgggttgaagattgatgattataatttctacgaaaatcaaacaggatctccatctcctctgccaaa |
122 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||| ||||||||||||||||||||||||||| | | |||||||||||||| |||||| ||||||| |
|
|
| T |
15793856 |
caaaggttggatgggtagttgtgtctcctagttgtgggatgaagattgatgattataatttctacggacaacaaacaggatctccttctcctttgccaaa |
15793757 |
T |
|
| Q |
123 |
tccaggtaatatt |
135 |
Q |
| |
|
||||||||||||| |
|
|
| T |
15793756 |
tccaggtaatatt |
15793744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University