View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21205_low_58 (Length: 253)
Name: NF21205_low_58
Description: NF21205
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21205_low_58 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 1562952 - 1562705
Alignment:
| Q |
1 |
tcaaataaatagatattatgaaacaacaaaaaatgtgccatcactaaattcttaaggtattgcaccatagttatgttaggatgttgggtgaataaaatca |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1562952 |
tcaaatatatagatattatgaaacaacaaaaaatgtgccatcactaaattcttaaggtattgcaccatagttatgttaggatgttgggtgaataaaatca |
1562853 |
T |
 |
| Q |
101 |
aacctggaaaatctccaccaacaagttcagtgaaagcatcaagtcaacttcaatactagaaccaaaacattaagtcagccagtctatagg--nnnnnnnn |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1562852 |
aacctggaaaatctccaccaacaagttcagtgaaagcattaagtcaacttcaatactagaaccaaaacattaagtcagccagtctataggtttttttttt |
1562753 |
T |
 |
| Q |
199 |
naatggtcctgacttaatccattctaaacaagtgaggtacttcatctc |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1562752 |
taatggtcctgacttaatccattctaaacaagtgaggtacttcatctc |
1562705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University