View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21205_low_60 (Length: 251)
Name: NF21205_low_60
Description: NF21205
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21205_low_60 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 13 - 196
Target Start/End: Original strand, 6706555 - 6706738
Alignment:
| Q |
13 |
aatatcatgatcatgatgaacaaagagaagacttattaatagtaacatggtagccacataaatatgatcaactatagattataagggttggcttttggtg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6706555 |
aatatcatgatcatgatgaacaaagagaagacttattaatagtaacatggtagccacataaatatgatcaactatagattataagggttggcttttggtg |
6706654 |
T |
|
| Q |
113 |
tttgagaggttcctttaattcttgcaaatctcactttctattaattctctttgtttggaagtttgtggggtaaactatttgcag |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6706655 |
tttgagaggttcctttaattcttgcaaatctcactttctattaattctctttgtttggaagtttgtggggtaaactatttgcag |
6706738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University