View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21205_low_72 (Length: 242)
Name: NF21205_low_72
Description: NF21205
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21205_low_72 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 8797925 - 8797693
Alignment:
| Q |
1 |
gtaactcaaccttcatctcactct--acataccccgcgtgcactctactgctttctcgctccttcataaaaaaccttgtattatccactagctagagaga |
98 |
Q |
| |
|
||||||||||||||||||| |||| ||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8797925 |
gtaactcaaccttcatctctctctctacatatcccgcgtgcactctactgctttctcactccttcataaaaaaccttgtattatccactagctagagaga |
8797826 |
T |
|
| Q |
99 |
caaagagagattcatttcttcattaaatgctgaaaatgtgtggaaagagagattaacactcattttccaaaggaaatctgtgcaggcttttgccagtagt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8797825 |
caaagagagattcatttcttcattaaatgctgaaaatgtgtggaaagagagattaacactcattttccaaaggaaatctgtgcaggcttttgccagtagt |
8797726 |
T |
|
| Q |
199 |
agaatccaaaaaacctcttcactacttcttcat |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
8797725 |
agaatccaaaaaacctcttcactacttcttcat |
8797693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University