View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21205_low_79 (Length: 238)
Name: NF21205_low_79
Description: NF21205
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21205_low_79 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 18 - 229
Target Start/End: Complemental strand, 25185788 - 25185575
Alignment:
| Q |
18 |
tgtgtgacataattttagtatata--ttctaacacttaatttagtctcgatttacccaaaaacaaatttattcaatttaattaacgatgatctagggcat |
115 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25185788 |
tgtgtgacataattttagtatatacattctaacactcaatttagtctcgatttaccgaaaaacaaatttattcaatttaattaacgatgatctagggcat |
25185689 |
T |
 |
| Q |
116 |
ggaaattggctaacccggaaggtcttttgctacaacgaccgaaacatgaaatctcactttcatagttaattgttatagacaacatatgtaaatatcgtag |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25185688 |
ggaaattggctaacccggaaggtcttttgctacaacaaccgaaacatgaaatctcactttcatagttaattgttatagacaacatatgtaaatatcgtag |
25185589 |
T |
 |
| Q |
216 |
aggaaaagatagtg |
229 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
25185588 |
aggaaaagatagtg |
25185575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University