View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21205_low_85 (Length: 230)
Name: NF21205_low_85
Description: NF21205
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21205_low_85 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 18 - 210
Target Start/End: Complemental strand, 34753572 - 34753381
Alignment:
| Q |
18 |
gaataatataaagtgagaactatttctaacgtcacctcagaaaacacacatattaagagagttaggttctt-aaacatatgcgtgtttctatcgttatgc |
116 |
Q |
| |
|
|||||| |||||||||||| || |||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||| ||| |||||| |
|
|
| T |
34753572 |
gaataacataaagtgagaattacttctaacgtcacctcagaaaacacacatattaagaggcttaggttcttgaaacatatgcgtgttt--atcattatgc |
34753475 |
T |
 |
| Q |
117 |
acatcaacgtaactgagtgtcgagacaggtgacaacgccatttgatttgaataaactttatgatgtgcatagcggtagaagcacacatatgctt |
210 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34753474 |
acatcaacataactgaatgtcgagacaggtgacaacgccatttgatttgaataaactttatgatgtgcatagcggtagaagcacacatatgctt |
34753381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University