View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21206_high_13 (Length: 232)
Name: NF21206_high_13
Description: NF21206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21206_high_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 3 - 117
Target Start/End: Complemental strand, 40657995 - 40657882
Alignment:
| Q |
3 |
ggactttctaacgtggtgaaaataaaaagctactagttatggctaaaataaaactcacatttactgttnnnnnnnntgcaaacaaatgttcgcaaggcat |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| ||| |||||||||||| ||||||| |
|
|
| T |
40657995 |
ggactttctaacgtggtgaaaataaaaagctactaattgtggctaaaataaaactcacatttactgtt-aaaaaaatgctaacaaatgttcgtaaggcat |
40657897 |
T |
|
| Q |
103 |
tgattaagctttcaa |
117 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
40657896 |
tgattaagctttcaa |
40657882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 216
Target Start/End: Complemental strand, 40657816 - 40657783
Alignment:
| Q |
183 |
caagacaaaaatttatgtttgcggatgctttaaa |
216 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
40657816 |
caagacaaaaatttatgtttacggatgctttaaa |
40657783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University