View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21206_low_10 (Length: 248)
Name: NF21206_low_10
Description: NF21206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21206_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 243
Target Start/End: Complemental strand, 11623814 - 11623589
Alignment:
| Q |
18 |
ctttctcaccaatgtgcatttggttggtagtctcagcacaagaaaggggaactaattttgtctctttttgtgtaacactataaataggtgtttttatttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11623814 |
ctttctcaccaatgtgcatttggttggtagtctcagcacaagaaaggggaactaattttgtctctttttgtgtaacactataaataggtgtttttatttt |
11623715 |
T |
|
| Q |
118 |
atgtgctaagcttgttctgtttgagttgatgtacatataaatataagcttgttctcttcactcttgagctgcttactttattattttcttatgataaagg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
11623714 |
atgtgctaagcttgttctgtttgagttgatgtacatgtaaatataagcttgttctcttcactcttgagctccttactttattattttcttatgataaagg |
11623615 |
T |
|
| Q |
218 |
aaagggtttggttaacgagtgcctcc |
243 |
Q |
| |
|
|| |||| | ||||||||||| |||| |
|
|
| T |
11623614 |
aaggggtcttgttaacgagtgtctcc |
11623589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University