View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21206_low_11 (Length: 242)
Name: NF21206_low_11
Description: NF21206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21206_low_11 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 62 - 242
Target Start/End: Original strand, 10244284 - 10244464
Alignment:
| Q |
62 |
gtttgggagagttttttgaaacaacctgtttaaacttagttgtgaagtcatagctatcacttgatgctttcaccctattgttttaacaaaaaatattatc |
161 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10244284 |
gtttgggagagtttttttaaacaacctatttaaacttagttgggaagttatagctatcacttgatgctttcaccctattgttttaacaaaaaatattatc |
10244383 |
T |
 |
| Q |
162 |
tccataagttcgtcaatattaatagtttctaacttatatgaaaatattcctaaaaacaaacttatatggaaatagttcgat |
242 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10244384 |
tccataagttattcaatattaatagtttctaacttatatgaaaatattcctaaaaacaaacttatatgaaaatagttcgat |
10244464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 7 - 43
Target Start/End: Original strand, 10244258 - 10244294
Alignment:
| Q |
7 |
ctactaacatacacacttgtgaaacggtttgggagag |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10244258 |
ctactaacatacacacttgtgaaacggtttgggagag |
10244294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University