View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21207_low_19 (Length: 288)
Name: NF21207_low_19
Description: NF21207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21207_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 23 - 278
Target Start/End: Complemental strand, 56388060 - 56387805
Alignment:
| Q |
23 |
caagatattctaattcgtgaaacgctgcgtatcagtgctgaattagcctcatcatctacaccccttctcccttcagatactaacttcatcggcagcagca |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
56388060 |
caagatattctaattcgtgaaacgctgcgtatcagtgctgaattagcctcatcatctacaccccttctcccttcagatactaccttcatcggcagcagca |
56387961 |
T |
|
| Q |
123 |
gattcatctgctgcgaacaaatcgatggccgtagatggaactacgttgccgatactgatgcctctggcaaattcaacaataattcctttcgctctctcag |
222 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56387960 |
gattcatctgttgcgaacaaatcgatggccgtagatggaactacgttgccgatactgatgcctctggcaaattcaacaataattcctttcgctctctcag |
56387861 |
T |
|
| Q |
223 |
tttacaaacccctaaacctcctcttgatgaattcgtctccttcgttagatcctatg |
278 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
56387860 |
tttacaaacacctaaacctcctcttgatgaattcatctccttcgttagatcctatg |
56387805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 122 - 253
Target Start/End: Original strand, 29732705 - 29732836
Alignment:
| Q |
122 |
agattcatctgctgcgaacaaatcgatggccgtagatggaactacgttgccgatactgatgcctctggcaaattcaacaataattcctttcgctctctca |
221 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||| ||||| || || || ||||||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
29732705 |
agattcatctgctgcgaggaaatcgatggccgtcgatggaattacgtggcagagaccaatgcctccgggcaattcaagaataattcctttcgctctctca |
29732804 |
T |
|
| Q |
222 |
gtttacaaacccctaaacctcctcttgatgaa |
253 |
Q |
| |
|
| ||||||||||| || ||||||||||||||| |
|
|
| T |
29732805 |
gcttacaaaccccaaagcctcctcttgatgaa |
29732836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 23 - 60
Target Start/End: Original strand, 29732612 - 29732649
Alignment:
| Q |
23 |
caagatattctaattcgtgaaacgctgcgtatcagtgc |
60 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||| |
|
|
| T |
29732612 |
caagatattctaatccgcgaaacgctgcgtatcagtgc |
29732649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University