View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21207_low_20 (Length: 274)
Name: NF21207_low_20
Description: NF21207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21207_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 83 - 259
Target Start/End: Complemental strand, 4711069 - 4710889
Alignment:
| Q |
83 |
atttactaactacctatagttattgagggttagttgattaatgcacgatgcatgctatcacaatcatataactatctatgatcttctctaggttgtttcg |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4711069 |
atttactaactacctatagttattgagggttagttgattaatgcacgatgcatgctatcacaatcatataactatctatgatcttctttaggttgtttcg |
4710970 |
T |
 |
| Q |
183 |
tgtaagttagtttggtgctgagagaaagaatgtgaacaa----atgatatagtgtatattacgtgattgatatctagaaaa |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4710969 |
tgtaagttagtttggtgctgagagaaagaatgtgaacaaatgaatgatatagtgtatattacgtgattgatatctagaaaa |
4710889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 4711114 - 4711068
Alignment:
| Q |
1 |
caaaatggaagagtaaattggtaatgaccctacaaaaggatcacgat |
47 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4711114 |
caaaatggaagtgtaaattggtaattaccctacaaaaggatcacgat |
4711068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University