View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21207_low_22 (Length: 263)
Name: NF21207_low_22
Description: NF21207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21207_low_22 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 15 - 263
Target Start/End: Original strand, 35523641 - 35523889
Alignment:
| Q |
15 |
gatccctttatgaaaaagagaaggattacaaaaacaattttatgcattttccaagaattatgcttggtatccccatccatagaaggggtgatgcataact |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || |
|
|
| T |
35523641 |
gatccctttatgaaaaagagaaggattacaaaaacaattttatgcattttccaagaattatgcttggtatccccatccatagaaggggtgatacatacct |
35523740 |
T |
 |
| Q |
115 |
gtagaatagttcacttcatcaatctggcttccccgagaaggatgttactctggtcttgcctttaagaattatgacttgagcccacgagtaaaaccatccc |
214 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35523741 |
gtagaatagttcacttcattaatctggcttccccgagaaggatgttactctggtcttgcctttaagaattatgacttgagcccacgagtaaaaccatccc |
35523840 |
T |
 |
| Q |
215 |
aaaagactaaccatgagttgagagagaattctggctaaccacccatgat |
263 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35523841 |
aaaagactaaccatgagttgagagagcattctggctaaccacccatgat |
35523889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University