View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21207_low_25 (Length: 250)
Name: NF21207_low_25
Description: NF21207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21207_low_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 11 - 234
Target Start/End: Complemental strand, 42341094 - 42340871
Alignment:
| Q |
11 |
caaaggtgtagattatttaaggatgatttggtaaagatgcaacaaatcgatctcaaatcaatggctgagatcaattaatttttgtaaatgtttgtatttg |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42341094 |
caaaggtgtagattatttaaggatgatttggtaaagatgcaacaaatcggtctcaaatcaatggctgagatcaattaatttttgtaaatgtttgtatttg |
42340995 |
T |
 |
| Q |
111 |
ttaatgcagagaatctggttccgtatttcacaccaaagcaagttgattccacattagcagtatcctattctagatggatatagtattaaatatttcataa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42340994 |
ttaatgcagagaatctggttccgtatttcacaccaaagcacgttgattccacattagcagtatcctattctagatggatatagtattaaatatttcataa |
42340895 |
T |
 |
| Q |
211 |
tttcatagagatgacacaagtttg |
234 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
42340894 |
tttcatagagatgacacaagtttg |
42340871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University