View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21207_low_26 (Length: 250)
Name: NF21207_low_26
Description: NF21207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21207_low_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 3 - 239
Target Start/End: Original strand, 4711104 - 4711340
Alignment:
| Q |
3 |
cttccattttgggttaattattactcattctagtcattttagaagagataaatgaatcaatttattgtatttggtcagcattttgaataaaatacatcat |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4711104 |
cttccattttgggttaattattactcattctagtcattttataagagataaatgagtcaatttattgtatttggtcagcattttgaataaaatacatcat |
4711203 |
T |
 |
| Q |
103 |
aaactttaattaatccagatggtcatttggttacatgtctattgtccatgacacatgtcatccacccaagtagtgcaaaatcttatcactggttacgtgt |
202 |
Q |
| |
|
|||||||||| | | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4711204 |
caactttaattgacctagatggtcatttggttacatgtctattgtccatgacacatgtcatccacccaagtagtgcaaaatcttatcactggttacgtgt |
4711303 |
T |
 |
| Q |
203 |
ctgtcataaacgtatttctatgaattgcatgcttctt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4711304 |
ctgtcataaacgtatttctatgaattgcatgcttctt |
4711340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University