View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2120R-Insertion-10 (Length: 156)
Name: NF2120R-Insertion-10
Description: NF2120R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2120R-Insertion-10 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 103; Significance: 1e-51; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 103; E-Value: 1e-51
Query Start/End: Original strand, 54 - 156
Target Start/End: Complemental strand, 37129184 - 37129082
Alignment:
| Q |
54 |
tgctcttatgagtaggggatgctaaaatgggttaacagggaccctcttaaattagcctgaaacatagcatgaattgataaggataataaggttgttcttt |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37129184 |
tgctcttatgagtaggggatgctaaaatgggttaacagggaccctcttaaattagcctgaaacatagcatgaattgataaggataataaggttgttcttt |
37129085 |
T |
 |
| Q |
154 |
agg |
156 |
Q |
| |
|
||| |
|
|
| T |
37129084 |
agg |
37129082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University